View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289-Insertion-5 (Length: 155)
Name: NF5289-Insertion-5
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289-Insertion-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 30347965 - 30347860
Alignment:
| Q |
8 |
catggtcacattgatgctctctcgaaaaatcatgaggaatctcaaagaaatactgagacatcaattaagaacttagagacacaaattagatagatttcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30347965 |
catggtcacattgatgctctctcgaaaaatcatgaggaatctcaaagaaatactgaaacatcaattaagaacttagagacacaaattaggtagatttcta |
30347866 |
T |
 |
| Q |
108 |
cacaac |
113 |
Q |
| |
|
|||||| |
|
|
| T |
30347865 |
cacaac |
30347860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University