View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289_high_2 (Length: 251)
Name: NF5289_high_2
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 106 - 239
Target Start/End: Original strand, 38269690 - 38269823
Alignment:
| Q |
106 |
tatgctaatggagatagaattgtataattaatttacctgcttgcttaggtactgaactccaacatccatgaccatactttgttatatgcctcagtagttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38269690 |
tatgctaatggagatagaattgtataattaatttacctgcttgcttaggtactgaactccaacatccatgaccatactttgttatatgcctcagtagttt |
38269789 |
T |
 |
| Q |
206 |
ttcatcttcttctggtgaccatagacctttccta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38269790 |
ttcatcttcttctggtgaccatagacctttccta |
38269823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 38269581 - 38269614
Alignment:
| Q |
1 |
agcctgcagctcttaccacatctttgcaaacctg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38269581 |
agcctgcagctcttaccacatctttgcaaacctg |
38269614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 139 - 239
Target Start/End: Complemental strand, 45437872 - 45437772
Alignment:
| Q |
139 |
tacctgcttgcttaggtactgaactccaacatccatgaccatactttgttatatgcctcagtagtttttcatcttcttctggtgaccatagacctttcct |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| || || ||||| ||| ||||||||||| || || |||||||||||||||||||| |
|
|
| T |
45437872 |
tacctgcttgcttaggaactgaactccaacatccatgaccatatttagtaatatgattcaaaagtttttcatcctcctcaggtgaccatagacctttcct |
45437773 |
T |
 |
| Q |
239 |
a |
239 |
Q |
| |
|
| |
|
|
| T |
45437772 |
a |
45437772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 19877216 - 19877172
Alignment:
| Q |
167 |
acatccatgaccatactttgttatatgcctcagtagtttttcatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
19877216 |
acatccatgaccatactttgttatatgctttagtagtttttcatc |
19877172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 229
Target Start/End: Original strand, 42789125 - 42789153
Alignment:
| Q |
201 |
agtttttcatcttcttctggtgaccatag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42789125 |
agtttttcatcttcttctggtgaccatag |
42789153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University