View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289_high_9 (Length: 211)
Name: NF5289_high_9
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 36337877 - 36338067
Alignment:
| Q |
18 |
cagtgatgataactcgtgccaaacaacaacagacatgcaaatggttcaaccttctcagaatcatttcacaaatttctgatagatgtataatta------- |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36337877 |
cagtgatgataactcatgccaaacaacaacagacatgcaaatggttcaaccttctcagaatcatttcacaaatttctgatagatgtataattaaagtcct |
36337976 |
T |
 |
| Q |
111 |
--aagtggttcttgtttggctgc----tttagaaaatgtcagttgttatctaggaaaaattatttatttattttacttttcaatcatctgt |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36337977 |
acaagtggttcttgtttggctgcttaatttagaaaatgtcagttgttatctaggaaaaattatttatttattttacttttcaatcatctgt |
36338067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 19284148 - 19284223
Alignment:
| Q |
21 |
tgatgataactcgtgccaaacaacaacagacatgcaaatggttcaaccttctcagaatcatttcacaaatttctga |
96 |
Q |
| |
|
|||||||||||| |||||| |||| ||||| |||||||||||||||||||||| | ||||||| ||| ||||||| |
|
|
| T |
19284148 |
tgatgataactcatgccaagcaaccacagaattgcaaatggttcaaccttctcatagtcatttctcaagtttctga |
19284223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University