View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289_low_7 (Length: 237)
Name: NF5289_low_7
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 3849155 - 3849392
Alignment:
| Q |
5 |
gtttgttcaacaaccatatgagacaattgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaa |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849155 |
gtttgttcaacaaccatatgagacagttgggaacatagtacacaaacacatgatcataaaatattgcattgaaacgtgtgagtgttgcttttgtggtgaa |
3849254 |
T |
|
| Q |
105 |
aatcttttaccaaatagtttgttgactgttttattttaaac--------------------taaaacatagttttgatgacttttatacgagttgaactt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849255 |
aatcttttaccaaatagtttgttgactgttttattttaaactaaattatggttccgttaaataaaacatagttttgatgacttttatacgagttgaactt |
3849354 |
T |
|
| Q |
185 |
tcatatacgtaccctatgcatgcaatgcaacttcttct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3849355 |
tcatatacgtaccctatgcatgcaatgcaacttcttct |
3849392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University