View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289_low_8 (Length: 236)
Name: NF5289_low_8
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 85 - 198
Target Start/End: Complemental strand, 43213845 - 43213732
Alignment:
| Q |
85 |
tcaaggaaggttcaaagcaatagaacgatcaaggctaagaggatgataatccagaacaaactgtagcnnnnnnnagctaggaagtgagctgcaaaattgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43213845 |
tcaaggaaggttcaaagcaatagaacgatcaaggctaagaggatgataatccagcacaaactgtagctttttttggctaggaagtgagctgcaaaattgt |
43213746 |
T |
 |
| Q |
185 |
ccttcatgtatgct |
198 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43213745 |
ccttcatgtatgct |
43213732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 43213930 - 43213893
Alignment:
| Q |
15 |
caaaggggttgttggaagtaggtggcaatgagaacctc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43213930 |
caaaggggttgttggaagtaggtggcaatgacaacctc |
43213893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University