View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290-Insertion-16 (Length: 105)
Name: NF5290-Insertion-16
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290-Insertion-16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 48983383 - 48983291
Alignment:
| Q |
8 |
cataggtgatgaaaagacaagtcgtgtgcacgaaaatgattcccttgaattcttaaatcaatcataagtacagatcaccataagactgagtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48983383 |
cataggtgatgaaaagacaagtcgtgtgcgcgaaaatgattcccttgaattcttaaatcaatcataagtacagatcaccataagactgagtga |
48983291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University