View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290-Insertion-18 (Length: 99)
Name: NF5290-Insertion-18
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290-Insertion-18 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 2e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 38788479 - 38788570
Alignment:
| Q |
8 |
taaaatatctgaatcttaaacaaacaccccatcacctacactatataataacacacggtagtgtgtttacttcacttcattctcaaaaacgg |
99 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38788479 |
taaaatatctgaatctaaaacaaataccccatcacctacactatataataacacacggtagtgtgtttacttcacttcattctcaaaaacgg |
38788570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 9e-27
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 38743932 - 38743845
Alignment:
| Q |
8 |
taaaatatctgaatcttaaacaaacaccccatcacctacactatataataacacacggtagtgtgtttacttcacttcattctcaaaaa |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38743932 |
taaaatatctgaatctcaaacaaacaccccatcaactac-ctatataataatacacggtagtgtgtttacttcacttcatattcaaaaa |
38743845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University