View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290-Insertion-2 (Length: 70)
Name: NF5290-Insertion-2
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290-Insertion-2 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 11740683 - 11740745
Alignment:
| Q |
8 |
caagctattttcaattttggtgattctaattcagatactggttgtatgtcagcagcatttcac |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11740683 |
caagctattttcaattttggtgattctaattcagatactggttgtatgtcagcggcatttcac |
11740745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 11736524 - 11736583
Alignment:
| Q |
8 |
caagctattttcaattttggtgattctaattcagatactggttgtatgtcagcagcattt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11736524 |
caagctattttcaattttggtgattctaattcagatactggttgtatgtctgcagcattt |
11736583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University