View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290-Insertion-3 (Length: 62)
Name: NF5290-Insertion-3
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290-Insertion-3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 25829627 - 25829573
Alignment:
| Q |
8 |
agggaatgatgtggctacactcatcttatcttatgaatctccatttcattccatc |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25829627 |
agggaatgatgtggctacactcatcttatcttatgaatctccatttcattccatc |
25829573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University