View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_high_15 (Length: 482)
Name: NF5290_high_15
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 63 - 225
Target Start/End: Complemental strand, 42779690 - 42779538
Alignment:
| Q |
63 |
acgaagtacttgttcctggcatctagttatgttgattttgatttagttggtgtcatattgctttcattaagtctatgtcttttttgggcttttgggactg |
162 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |||||||||| ||||| || ||||||||| |||| |
|
|
| T |
42779690 |
acgaagtacttgttcctagcatctagttacgttgattttgatttagttgttgtcat--tgctttcatttagtct--gtattttttggg--------actg |
42779603 |
T |
 |
| Q |
163 |
ccgtgtgtgtt--gttggatttgtatctttgttccatgggagtttggttataacaagttgcaagt |
225 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
42779602 |
ccgtgtgcgttttgttggatttgtatctttgtttcatgcgagtttggttataacaagttggaagt |
42779538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 55 - 103
Target Start/End: Original strand, 29554969 - 29555017
Alignment:
| Q |
55 |
gtgtagccacgaagtacttgttcctggcatctagttatgttgattttga |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29554969 |
gtgtggccacgaagtacttgttcctggcatctagttatgttgattttga |
29555017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 428 - 463
Target Start/End: Complemental strand, 24487416 - 24487381
Alignment:
| Q |
428 |
tgggtttagtttggttcttcaatttgtcttggtttg |
463 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24487416 |
tgggtttagtttggtttttcaatttgtcttggtttg |
24487381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University