View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5290_high_46 (Length: 249)

Name: NF5290_high_46
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5290_high_46
NF5290_high_46
[»] chr3 (1 HSPs)
chr3 (105-231)||(26883995-26884121)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 105 - 231
Target Start/End: Original strand, 26883995 - 26884121
Alignment:
105 attaggatcatatgaactcctagatttggacccattttcaactaagggaaaaaggccaaaataccaggaccatggttcttgttgttcaaggaacaaatcc 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
26883995 attaggatcatatgaactcctagatttggacccattttcaactaagggaaaaaggccaaaataccaggaccatggttcttgttgctcaaggaacaaatcc 26884094  T
205 tctggaacacaaatcgctccatgagca 231  Q
    |||||||||||||||||||||||||||    
26884095 tctggaacacaaatcgctccatgagca 26884121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University