View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_high_50 (Length: 221)
Name: NF5290_high_50
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 42223931 - 42223729
Alignment:
| Q |
1 |
tctcttgcttactttggaaatggggtggcttggacaacttactctctcctccctttcgacaaattcatcactgtaaacaagctaaatccnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42223931 |
tctcttgcttcctttggaaatggtgtggcttggacaacttactctctcctccctttcgacaaattcatcactgtaaacaaactaaatccttttgcttttt |
42223832 |
T |
 |
| Q |
101 |
nnnnnnnnncctcgacatattgatgaaatagacgtaaagctaatgaatgaccattgctgttgttctttgttaattctcagataccaaatggaattggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42223831 |
ttcctttttcctcgacatattgatgaaatagacgtaaagctaatgaatgaccattgttgttgttctttgttaactctcagataccaaatggaattggaac |
42223732 |
T |
 |
| Q |
201 |
att |
203 |
Q |
| |
|
||| |
|
|
| T |
42223731 |
att |
42223729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University