View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_high_52 (Length: 216)
Name: NF5290_high_52
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 34606583 - 34606766
Alignment:
| Q |
19 |
atcatacaaaattacataacacaaacattaataaaagtaactaataatcttcaggagccaaaggttgatgaatcggattagtatgaggaggctcaactgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34606583 |
atcatacaaaattacataacacaaacattaataaaagtaactaataatcttcaggagccaaaggttgatgaatcggattagtatgaggaggctcaactgg |
34606682 |
T |
|
| Q |
119 |
aaccataatatattcatataaaagtgctgctattgcagctccaagaaatggacccacccaaaagatccaatgatagtgccatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34606683 |
aaccataatatattcatataaaagtgctgctattgcagctccaagaaatggacccacccagaagatccaatgatagtgccatct |
34606766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University