View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5290_low_15 (Length: 482)

Name: NF5290_low_15
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5290_low_15
NF5290_low_15
[»] chr5 (1 HSPs)
chr5 (63-225)||(42779538-42779690)
[»] chr3 (1 HSPs)
chr3 (55-103)||(29554969-29555017)
[»] chr7 (1 HSPs)
chr7 (428-463)||(24487381-24487416)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 63 - 225
Target Start/End: Complemental strand, 42779690 - 42779538
Alignment:
63 acgaagtacttgttcctggcatctagttatgttgattttgatttagttggtgtcatattgctttcattaagtctatgtcttttttgggcttttgggactg 162  Q
    ||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||  |||||||||| |||||  || |||||||||        ||||    
42779690 acgaagtacttgttcctagcatctagttacgttgattttgatttagttgttgtcat--tgctttcatttagtct--gtattttttggg--------actg 42779603  T
163 ccgtgtgtgtt--gttggatttgtatctttgttccatgggagtttggttataacaagttgcaagt 225  Q
    ||||||| |||  |||||||||||||||||||| |||| ||||||||||||||||||||| ||||    
42779602 ccgtgtgcgttttgttggatttgtatctttgtttcatgcgagtttggttataacaagttggaagt 42779538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 55 - 103
Target Start/End: Original strand, 29554969 - 29555017
Alignment:
55 gtgtagccacgaagtacttgttcctggcatctagttatgttgattttga 103  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||    
29554969 gtgtggccacgaagtacttgttcctggcatctagttatgttgattttga 29555017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 428 - 463
Target Start/End: Complemental strand, 24487416 - 24487381
Alignment:
428 tgggtttagtttggttcttcaatttgtcttggtttg 463  Q
    |||||||||||||||| |||||||||||||||||||    
24487416 tgggtttagtttggtttttcaatttgtcttggtttg 24487381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University