View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_low_43 (Length: 264)
Name: NF5290_low_43
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 15307305 - 15307539
Alignment:
| Q |
20 |
ttggactttatgagttaggttttccaatggtatgtatatttacaacaacaatatctaatccttannnnnnncctacatttttgaattataattatattaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15307305 |
ttggactttatgagttaggttttccaatggtatgtatatttacaacaacaatatctaatccttatttttttcctacatttttgaattataattatattaa |
15307404 |
T |
 |
| Q |
120 |
ttgttatgattcacactttcttaactgtgccttttgaatcttagcttgcaaaatgtatagagattggagttccagaaattgtaatcctagtattcctttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15307405 |
ttgttatgattcacactttcttaactgtgccttttgaatcttagcttgcaaaatgtatagagattggacttccagaaattgtaatcctagtattcctttc |
15307504 |
T |
 |
| Q |
220 |
acaggtgaaagtctgtttgttcttggtttcctttg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15307505 |
acaggtgaaagtctgtttgttcttggtttcctttg |
15307539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University