View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_low_44 (Length: 258)
Name: NF5290_low_44
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_low_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 27 - 258
Target Start/End: Original strand, 34452975 - 34453209
Alignment:
| Q |
27 |
tatttatgatgatagtactaaacacattaaatattttgatatcatggcggctttgaaacgcaagtcaaactatcatggaaacgtgattgcaaacacctct |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34452975 |
tatttatgatgatagtactaaacacattaaatattttgatatcatggcggctttggaacgcaagtcaaactatcatggaaacgtgattccaaacacctct |
34453074 |
T |
 |
| Q |
127 |
tattatatagtattaacctaagttacaaggtaccactataccagctatgatatatccttgcaca---nnnnnnnnnnaaaaagacaaaaaatatagtaga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34453075 |
tattatatagtattaacctaagttacaaggtaccactataccagctatgatatatccttgcacatttttttttttttaaaaagacaaaaaatatagtaga |
34453174 |
T |
 |
| Q |
224 |
aacaaacaatcaaatcacaagaagtgccaatataa |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453175 |
aacaaacaatcaaatcacaagaagtgccaatataa |
34453209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University