View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_low_45 (Length: 258)
Name: NF5290_low_45
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 45214291 - 45214064
Alignment:
| Q |
20 |
tataaaccatttgttttttcacaagggacaatatgcttgaccaaaggtaggagtcatttttgatatcgctctcaaccacagatgaagatgtcgttcctt- |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45214291 |
tataaacaatttgttttttcacaagggacaatatgcttgaccaaaggtgggagtcatttttgatatcgctctcaaccacagatggagatgtcgttccttt |
45214192 |
T |
 |
| Q |
119 |
cccatatatttatcatatcgattttgttttcccaatgttgaagagcatgatagtgatcgaagttcctccaatatgttcaatattaacgcatgaaaaagag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45214191 |
cccatatatttatcatatcgattttgttttcccaatgttgaagagcatgatagtgatcgaagttcctccaatatgttcaatattaacgcatcaaaaagag |
45214092 |
T |
 |
| Q |
219 |
atatgatagttgtcctctaactcacctt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45214091 |
atatgatagttgtcctctaactcacctt |
45214064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University