View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_low_52 (Length: 235)
Name: NF5290_low_52
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_low_52 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 25896377 - 25896602
Alignment:
| Q |
14 |
acaagcatcataattgtgttgcatatttactggtttatgtggatgatatcatcctcaccggaagctctccttccc-tccttca--gtcttacttccaaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
25896377 |
acaagcatcataattgtgttgcatatttactggtttatgtggatgatatcatcctcaccggaagctctccttcccctacttcacagtcttacttccaaag |
25896476 |
T |
|
| Q |
111 |
tgaatcaagtttttgctctcaagcagcttggcaaccttgactactttctgggcacagaggtgaaacttcaacctgatggtactcttcttctgtctcaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
25896477 |
tgaatcaagtttttgctctcaagcagcttggcaaccttgactactttctgggcatagaggtgaaacctcaacctgatggtactcttattctgtctcaaac |
25896576 |
T |
|
| Q |
211 |
caaatat-tttgtgtccttctccttc |
235 |
Q |
| |
|
||||||| |||||| ||||||||||| |
|
|
| T |
25896577 |
caaatatatttgtgaccttctccttc |
25896602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University