View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5290_low_59 (Length: 205)
Name: NF5290_low_59
Description: NF5290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5290_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 13074446 - 13074619
Alignment:
| Q |
17 |
aagaaaatcaacgaacatgcaatggaacaagctttgtgctcacttctataacacaaaggctgattgaaagtgtgtttagtatcaatgtctaacaactgca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13074446 |
aagaaaatcaacgaacatgcaatggaacaagctttgtgctcacttctataacataaaggctgattgaaagtgtgtttagtatcaatatctaacaactgca |
13074545 |
T |
 |
| Q |
117 |
tgacactaacttacatgattaaattcaatcaattttatcttttaaatcattatcaatgttcacatattattagt |
190 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13074546 |
tgacactaacctacatgattaaattcaatcaattttatcttttaagtcattatcaatgttcacatattattagt |
13074619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University