View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291-Insertion-10 (Length: 107)
Name: NF5291-Insertion-10
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5291-Insertion-10 |
 |  |
|
| [»] scaffold0727 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0727 (Bit Score: 50; Significance: 4e-20; HSPs: 1)
Name: scaffold0727
Description:
Target: scaffold0727; HSP #1
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 4353 - 4254
Alignment:
| Q |
8 |
aatcctagaggtaacaaagaattannnnnnncaaaatacctgtcaaacacagtgacaatcgnnnnnnntacacttcgcaattttaggagaacaacaaagt |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
4353 |
aatcctagaggtaacaaagaattatttttttcaaaatacctgtcaaacacagtgacaatcgaaaaaaatacacttcgcagttttaggagaacaaaaaagt |
4254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 4e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 23552218 - 23552119
Alignment:
| Q |
8 |
aatcctagaggtaacaaagaattannnnnnncaaaatacctgtcaaacacagtgacaatcgnnnnnnntacacttcgcaattttaggagaacaacaaagt |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
23552218 |
aatcctagaggtaacaaagaattatttttttcaaaatacctgtcaaacacagtgacaatcgaaaaaaatacacttcgcagttttaggagaacaaaaaagt |
23552119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University