View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5292-Insertion-1 (Length: 255)
Name: NF5292-Insertion-1
Description: NF5292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5292-Insertion-1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 255
Target Start/End: Original strand, 27843978 - 27844232
Alignment:
| Q |
8 |
gacaacaaatactccatgcacgcctctgcaataaataatgggtcatcttcatattgtagatggctcac-------caatacctttgagtcatgtatatga |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
27843978 |
gacaacaaattctccatgcacgcctctccaataaataatgggtcatcttcatattgtagatggctcaccattcaccaatacctttgagtcatgtatctga |
27844077 |
T |
 |
| Q |
101 |
tacccataaaatatcccaactgcacttcaatatccaataaacccctgacttcttttccagacttccaccaataaaacaaaagggtgctaacagatcacct |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27844078 |
tacccataaaatatcccaactgcaccacaatatccaataaacccctgacctctcttccagacttccaccaataaaacaaaagggtactaacagatcacct |
27844177 |
T |
 |
| Q |
201 |
tgcataagcccgctactaattttcatctcttccatgggaatcccattcgccaata |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844178 |
tgcataagcccgctactaattttcatctcttccatgggaatcccattcgccaata |
27844232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University