View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5292_high_7 (Length: 367)

Name: NF5292_high_7
Description: NF5292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5292_high_7
NF5292_high_7
[»] chr4 (2 HSPs)
chr4 (127-251)||(49923409-49923533)
chr4 (4-63)||(49923284-49923343)
[»] chr1 (2 HSPs)
chr1 (135-222)||(26777576-26777663)
chr1 (4-63)||(26777732-26777791)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 127 - 251
Target Start/End: Original strand, 49923409 - 49923533
Alignment:
127 aggtttgttttcacttgttctgttcgttggatttctttggatcagtgccaagatggaatttgtatttcctgctgtaagtgtttgcctaatttgtattaat 226  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49923409 aggtttgttttctcttgttctgttcgttggatttctttggatcagtgccaagatggaatttgtatttcctgctgtaagtgtttgcctaatttgtattaat 49923508  T
227 atttcagtttgcttatcgaattggt 251  Q
    | |||||||||||||||||||||||    
49923509 aattcagtttgcttatcgaattggt 49923533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 4 - 63
Target Start/End: Original strand, 49923284 - 49923343
Alignment:
4 gttctctctgattctactcgtcttcattatccatgcaatggttggttactgtctttgtta 63  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
49923284 gttctctctgattctactcgtcttcattatcgatgcaatggttggttactgtctttgtta 49923343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 135 - 222
Target Start/End: Complemental strand, 26777663 - 26777576
Alignment:
135 tttcacttgttctgttcgttggatttctttggatcagtgccaagatggaatttgtatttcctgctgtaagtgtttgcctaatttgtat 222  Q
    |||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||| || | |||||||||||||| | ||||||||    
26777663 tttcgcttgttctgttggttggacttctttggatcagtgccaagatggaatttgtatctcttactgtaagtgtttgcatgatttgtat 26777576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 4 - 63
Target Start/End: Complemental strand, 26777791 - 26777732
Alignment:
4 gttctctctgattctactcgtcttcattatccatgcaatggttggttactgtctttgtta 63  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
26777791 gttctctctgattctactcgtcttcattatcgatgcaatggttggttactgtctttgtta 26777732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University