View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5292_low_2 (Length: 253)
Name: NF5292_low_2
Description: NF5292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5292_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 119 - 243
Target Start/End: Complemental strand, 49923533 - 49923409
Alignment:
| Q |
119 |
accaattcgataagcaaactgaaatattaatacaaattaggcaaacacttacagcaggaaatacaaattccatcttggcactgatccaaagaaatccaac |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49923533 |
accaattcgataagcaaactgaattattaatacaaattaggcaaacacttacagcaggaaatacaaattccatcttggcactgatccaaagaaatccaac |
49923434 |
T |
 |
| Q |
219 |
gaacagaacaagtgaaaacaaacct |
243 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
49923433 |
gaacagaacaagagaaaacaaacct |
49923409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 148 - 235
Target Start/End: Original strand, 26777576 - 26777663
Alignment:
| Q |
148 |
atacaaattaggcaaacacttacagcaggaaatacaaattccatcttggcactgatccaaagaaatccaacgaacagaacaagtgaaa |
235 |
Q |
| |
|
|||||||| | |||||||||||||| | || ||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
26777576 |
atacaaatcatgcaaacacttacagtaagagatacaaattccatcttggcactgatccaaagaagtccaaccaacagaacaagcgaaa |
26777663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University