View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5293-Insertion-3 (Length: 310)
Name: NF5293-Insertion-3
Description: NF5293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5293-Insertion-3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 7 - 310
Target Start/End: Complemental strand, 893997 - 893694
Alignment:
| Q |
7 |
agcatagatagatgattcaatttagttttaattctgattaattgatttgcgggaattacatgtgatttattgatgtcgttgtgactatggttgttcatgc |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893997 |
agcatagatagatgattcaatttagatttaattctgattaatttatttgcgggaattacatgtgatttattgatgtcgttgtgactatggttgttcatgc |
893898 |
T |
|
| Q |
107 |
tctttcctcttaaaatagacggacagttacggtgcatttcggtttttaatctctcttatatatttctttatttagttagatttattcagaaattgttgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893897 |
tctttcctcttaaaatagacggacagttacggtgcatttcggtttttaatctctcttatatatttctttatttagttagatttattcagaaattgttgaa |
893798 |
T |
|
| Q |
207 |
ttcatatgttgattcaaatcctgtaatatcatgttatgtgatttactgtttaattcatttgtttcaatttaattatctttgtttttcccatctcatgtct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893797 |
ttcatatgttgattcaaatcctgtaatatcatgttatgtgatttactgtttaattcatttgtttcaatttaattatctttgtttttcccatctcatgtct |
893698 |
T |
|
| Q |
307 |
cggg |
310 |
Q |
| |
|
|||| |
|
|
| T |
893697 |
cggg |
893694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University