View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5293_low_6 (Length: 290)
Name: NF5293_low_6
Description: NF5293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5293_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 39922604 - 39922877
Alignment:
| Q |
19 |
atcttatactgtctgttatacacgcatgagcagaaactaatctctccagaaaattgatattccatttaacggttcgnnnnnnnnnnnnnnnnnnnnnnnc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39922604 |
atcttatactgtctgttatacacgcatgagcagaaactaatctctccagaaaattgatattccatttaacggttcgatattttttgatatatattttttc |
39922703 |
T |
|
| Q |
119 |
atacacattggtcaatgatcaaacattaaattaaatgatcaagggtccaagttaataccatttttgctagagtatgttgattataagttcatagat--at |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
39922704 |
atacacattggtcaatgatcaaacattaaattaaatgatcaagggtccaagttaataccatttatgctagagtatgttgattataagttcatagatacat |
39922803 |
T |
|
| Q |
217 |
ccttaaaacaaaaagtccatagatacataatcctttcttggtgatgtgatatagtatgggtttgatttagtttt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39922804 |
ccttaaaacaaaaagtccatagatacataatgctttcttggtgatgtgatatagtatgggtttgatttagtttt |
39922877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University