View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294-Insertion-5 (Length: 149)
Name: NF5294-Insertion-5
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 42926013 - 42925872
Alignment:
| Q |
8 |
atctcctggctcggtttctccaccggtggagtctcctccgatgtctccgatgactcgatctttgggaagatctgtgggttctagctctgtaaatgaaatg |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42926013 |
atctcctggttcggtttctccaccggtggagtctcctccgatgtctccgatgactcgatctttgggaagatctgtgggttctagctctgtgaatgaaatg |
42925914 |
T |
|
| Q |
108 |
gtggcttctctgagaaacttacaacttggcaccatgaagtca |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42925913 |
gtggcttctctgagaaacttacaacttggtaccatgaagtca |
42925872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University