View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_high_25 (Length: 337)
Name: NF5294_high_25
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_high_25 |
 | |
|
| [»] chr6 (5 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 5e-87; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 155 - 337
Target Start/End: Complemental strand, 30943686 - 30943504
Alignment:
| Q |
155 |
ctaataggtaagctgcatatgatttgctaaagaaattgggaaagctaaaatcagaaataggaatggggaactaaaaactaaagagcaggattttaaataa |
254 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943686 |
ctaataggtaagctgcatatgattggctaaagaagttgggaaagctaaaaacagaaataggaatggggaactaaaaactaaagagcaggattttaaataa |
30943587 |
T |
|
| Q |
255 |
atcaaggtttgcaactgcaatttaggccgtgatattacggctaatgatatagtgataaaagaaaaaacatgcttttgtaaaga |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943586 |
atcaaggtttgcaactgcgatttaggccgtgatattacgggtaatgatatagtgataaaagaaaaaacatgcttttgtaaaga |
30943504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 30943820 - 30943761
Alignment:
| Q |
20 |
gtatcacctagaatgattttcattttccctttccagcttagctgcttacctgcgatagtt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30943820 |
gtatcacctagaatgattttcattttccctttccagctcagctgcttacctgcgatagtt |
30943761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 30959922 - 30959863
Alignment:
| Q |
20 |
gtatcacctagaatgattttcattttccctttccagcttagctgcttacctgcgatagtt |
79 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| || | |||||||||||||||||| |
|
|
| T |
30959922 |
gtattacctagaatgattttcattttcccttgccaactcatttgcttacctgcgatagtt |
30959863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 31223030 - 31222979
Alignment:
| Q |
20 |
gtatcacctagaatgattttcattttccctttccagcttagctgcttacctg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||| | ||||||||||| |
|
|
| T |
31223030 |
gtatcacctagaatgattttcattttcccttgcctgctcaactgcttacctg |
31222979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 30954263 - 30954205
Alignment:
| Q |
20 |
gtatcacctagaatgattttcattttccctttccagcttagctgcttacctgcgatagt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || | |||||| |||||||||| |
|
|
| T |
30954263 |
gtatcacctagaatgattttcattttcccttgccaactcaaatgcttatctgcgatagt |
30954205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University