View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_high_38 (Length: 266)
Name: NF5294_high_38
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 4567973 - 4567739
Alignment:
| Q |
13 |
aatattcagaaaatgactatttaggtctattaattgcttacagacacctcaaattatctaaaaagcaccaaacaataattatctaccgttttgaagcgaa |
112 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4567973 |
aatatttagaaaatgactatttagggttattaattgcttacagacacctcaaattatctaaaaagcaccaaacaataattatctaccgttttgaagtgaa |
4567874 |
T |
 |
| Q |
113 |
caatagttaattggcattctgcaaacggtaatagctatccgtgagcagttgctaggtgtctaaagagcaatcttcaaatattgaggagaaattaaacaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
4567873 |
caatagttaattggcattctgcaaacggtaatagctatttgtgagcagttgctaggtgtctaaagagcaatcttcaaatattgagaagaaatttaacaac |
4567774 |
T |
 |
| Q |
213 |
tttcatcaacttgcttttgcaatatgtctgaacat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567773 |
tttcatcaacttgcttttgcaatatgtctgaacat |
4567739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 153 - 190
Target Start/End: Original strand, 5934467 - 5934504
Alignment:
| Q |
153 |
gtgagcagttgctaggtgtctaaagagcaatcttcaaa |
190 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5934467 |
gtgagcaattgctagatgtctaaagagcaatcttcaaa |
5934504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University