View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_high_47 (Length: 245)
Name: NF5294_high_47
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 25 - 231
Target Start/End: Original strand, 42933593 - 42933793
Alignment:
| Q |
25 |
caacaacaatttgcctctgtggctaatcatcattataatgacatgcatgtcattaatcataacaataacgaggataatgatgctgctttgaatattatca |
124 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933593 |
caacaacaatttgccgctgtgtctaatcatcattataatgacatgcatgtcattaatcataacaataacgaggataatgatgctgctttgaatattatca |
42933692 |
T |
 |
| Q |
125 |
atcattttaaccagcagcattttgttgatgatcaactgaatatgaatatgaatatgctgcctcaacagcaattgcaactgcagcaacaatatgttgtcga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42933693 |
atcattttaaccagcagcattttgttgatgatcaac------tgaatatgaatatgctgcctcaacagcaattgcaactgcagcagcaatatgttgtcga |
42933786 |
T |
 |
| Q |
225 |
tgatgtc |
231 |
Q |
| |
|
||||||| |
|
|
| T |
42933787 |
tgatgtc |
42933793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University