View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_high_52 (Length: 235)
Name: NF5294_high_52
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 65 - 211
Target Start/End: Complemental strand, 53788241 - 53788094
Alignment:
| Q |
65 |
tgtaatggaagagaatgtcaaattgaatcaagatgctggaagtgattaaatattggaaagaaaattattcaaatactcaaataatggaa-cagttgattt |
163 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
53788241 |
tgtaatagaagagaatgttaaattgaatcaagatgctggaagtgattaaatattgggaaaaaaattattgcaatactcaaataatggaaccggttgattt |
53788142 |
T |
 |
| Q |
164 |
tcccaacaagcatttgcaaatgaatttaacgaagtcctagatagatgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53788141 |
tcccaacaagcatttgcaaatgaatttaacgaagtcctggatagatgg |
53788094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 5273237 - 5273172
Alignment:
| Q |
45 |
gttccacccctgaacgagattgtaatggaagagaatgtcaaattgaatcaagatgctggaagtgat |
110 |
Q |
| |
|
|||||| |||| || ||||||||||||||||||||||| | | ||||| ||||| ||| ||||||| |
|
|
| T |
5273237 |
gttccatcccttaatgagattgtaatggaagagaatgtgagaatgaatgaagattctgcaagtgat |
5273172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University