View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_high_54 (Length: 233)
Name: NF5294_high_54
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 34669994 - 34669790
Alignment:
| Q |
19 |
gcatcacagatcaaattccgtgctatccaagaaaccattctcagaattatgtattactacagatgtttctttctcagctaggcctagatcagggcaatca |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
34669994 |
gcatcccagatcaaattccgtgctatccaagaaaccattctcagaattatgtattactacagatgtttctttctcagctagtcctagatcagtgcaatca |
34669895 |
T |
 |
| Q |
119 |
ggattaaactctattgattcagaaagggtattatccaattgaatcattgttctgcagatactagtatcctctgctgaaggagcaaaccattggcaaagat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34669894 |
ggattaaactctattgattcagaaagggtattatccaattgaatcatttttctgcagatactagtatcctctgatgaaggagcaaaccattggcaaagat |
34669795 |
T |
 |
| Q |
219 |
catcc |
223 |
Q |
| |
|
||||| |
|
|
| T |
34669794 |
catcc |
34669790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University