View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_low_29 (Length: 326)
Name: NF5294_low_29
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 45 - 313
Target Start/End: Complemental strand, 56312712 - 56312444
Alignment:
| Q |
45 |
atgaattagagcagtagtatttggtaattaaggagaagtaattattatataccttttgatatcgttcggtttcatgttggggtaatctatactcattcat |
144 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312712 |
atgaattagagcagtaatatttggtaattaaggagaagtaattattatataccttttgatatcgttcggtttcatgttggggtaatctatactcattcat |
56312613 |
T |
|
| Q |
145 |
aatccaactggttcggatgcctttaggagcttttccagaatagaaaactagggttttcttgagtccaattgaacggaagttttcagttcgaatcatccta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312612 |
aatccaactggttcggatgcctttaggagcttttccagaatagaaaactagggttttcttgagtccaattgaacggaagttttcagttcgaatcatccta |
56312513 |
T |
|
| Q |
245 |
tctgctcctgttgccttccaataaccagaagttgttacacgatttggacgatcaccgtttcgatacttc |
313 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312512 |
tccgctcctgttgccttccaataaccagaagttgttacacgatttggacgatcaccgtttcgatacttc |
56312444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University