View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_low_31 (Length: 322)
Name: NF5294_low_31
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 3 - 321
Target Start/End: Original strand, 42933795 - 42934110
Alignment:
| Q |
3 |
gtattaaccctaattatgttcctttacaagaggatcttaattcatgggcaaacaatattaatataccgttgtctcctttaactttggagggtaacaataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933795 |
gtattaaccctaattatgttcctttacaagaggatcttaattcatgggcaaacaatattaatataccgttgtctcctttaactttggagggtaacaataa |
42933894 |
T |
 |
| Q |
103 |
cgaagaagacggtgaagaagatcaggaacgtgttggtgatgatcaaggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggat |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933895 |
ggaagaagatggtgaagaagatcaggaacgtgttggtgatgatcaaggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggat |
42933994 |
T |
 |
| Q |
203 |
accaacagcagaagtagtattgatccggggcaccaggtttgttatttagttggtgatctattttattttatgttttcccaatttcattttgtaaatttgt |
302 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42933995 |
accaacagc---agtagtattgatccggggcaccaggtttgttatttagttggtgatctattttattttatgttttcccaatttcgttttgtaaatttga |
42934091 |
T |
 |
| Q |
303 |
gtttctttggttgaattaa |
321 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42934092 |
gtttctttggttgaattaa |
42934110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University