View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_low_38 (Length: 289)
Name: NF5294_low_38
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 12 - 142
Target Start/End: Original strand, 38753088 - 38753218
Alignment:
| Q |
12 |
agagaagatggtggtggggacggtgtgatgaggtggttgtgatagcggtgttacgacggtggtgagaatggcgtgatggtggcggcgagaagatcagagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38753088 |
agagaagatggtggtggggacggtgtgatgaggtggttgtgatagcggtgttacgacggtggtgagaatggcgtgatggtggcggcgagaagatcagagt |
38753187 |
T |
|
| Q |
112 |
acggcggtgcgacggtggttcgtcgtttcag |
142 |
Q |
| |
|
|| |||||||||||||||| |||||||||| |
|
|
| T |
38753188 |
acaacggtgcgacggtggtttgtcgtttcag |
38753218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 38753298 - 38753350
Alignment:
| Q |
222 |
ctgatgatacattgggatttacaaaatta-ccccattttttaaatattgaaat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
38753298 |
ctgatgatacattgggatttacaaaattacccccttttttttaatattgaaat |
38753350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 131
Target Start/End: Original strand, 53296990 - 53297110
Alignment:
| Q |
11 |
cagagaagatggtggtggggacggtgtgatgaggtggttgtg-atagcggtgttacgacggtggtgagaatggcgtgatggtggcggcgagaagatcaga |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||| ||| ||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53296990 |
cagagaagatggtggtggggacgc-gtgatgaggtggttgtggatagcgatgtgacggtggtggtgagattggcgtgatggtggcggcgagaagatcagg |
53297088 |
T |
|
| Q |
110 |
gtacggcggtgcgacggtggtt |
131 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
53297089 |
gtacgatggtgcgacggtggtt |
53297110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University