View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_low_48 (Length: 251)
Name: NF5294_low_48
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 110 - 231
Target Start/End: Original strand, 26216551 - 26216672
Alignment:
| Q |
110 |
tgatccgatcaggacttctatgagttcaatgcggcggttcaagtttgaaaatgctttgttggaagaaccaggctttgaggattttgagtcaatgttggca |
209 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216551 |
tgatcccatcagtacttctatgagttcaacgcggcggttcaagtttgaaaatgctttgttggcagaaccaggctttgaggattttgagtcaatgttggca |
26216650 |
T |
|
| Q |
210 |
tatctaaaatggagttaatatt |
231 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
26216651 |
tatctcaaatggagttaatatt |
26216672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 26216428 - 26216518
Alignment:
| Q |
18 |
cacagtggaggtaaaacttgatagagcacgcaccgatggtgatttgtgtcatacatttcctaatgcacatctagaatgcttgacaactact |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216428 |
cacagtggaggtaaaactggatagagcacgcaccaatggtgatttgtgtcaaacatttcctaatgcacatctagaatgcttgacaactact |
26216518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University