View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5294_low_55 (Length: 237)
Name: NF5294_low_55
Description: NF5294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5294_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 41132938 - 41133059
Alignment:
| Q |
10 |
catcatcaagatttaacacttgtatataaatagttgtggagcctacttcgttttcaccatacccaactcagtcagatccattgccttcttcttccccttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41132938 |
catcatcaagatttaacacttgtatataaatagttgtggagcctacttcgttttcaccatacccaactcagtcagatccattgccttcttcttccccttc |
41133037 |
T |
|
| Q |
110 |
ccccctttctcaccattttctt |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41133038 |
ccccctttctcaccattttctt |
41133059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 225
Target Start/End: Original strand, 41133124 - 41133153
Alignment:
| Q |
196 |
tctaagtatttgtttatttaaatcaagaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41133124 |
tctaagtatttgtttatttaaatcaagaaa |
41133153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University