View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5295-Insertion-4 (Length: 132)
Name: NF5295-Insertion-4
Description: NF5295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5295-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 402707 - 402583
Alignment:
| Q |
8 |
cgattttggtaccactggcatgatctaaggtgaaaccgttatagggaccaacaccagcttcaagaagaccatcacgaacagcagattgccacgttttcaa |
107 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
402707 |
cgattttggtaccagtagcatgatctaaggtgaaaccgttataaggaccaacaccagcttcaagaagaccatcacgaacagcggattgccacgttttcaa |
402608 |
T |
 |
| Q |
108 |
atcaggacgaaacacgatttcacgt |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
402607 |
atcaggacgaaacacgatttcacgt |
402583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University