View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5295_high_2 (Length: 367)
Name: NF5295_high_2
Description: NF5295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5295_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 55 - 359
Target Start/End: Original strand, 32861017 - 32861321
Alignment:
| Q |
55 |
tgacctgggtggaaatctctagtagtaaaaagagaacgacccttttctgagatggtggaaactgttaaattacaattcttcagtgcttgttgcaattcct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861017 |
tgacctgggtggaaatctctagtagtaaaaagagaacgacccttttctgagatggtggaaactgttaaattacaattcttcagtgcttgttgcaattcct |
32861116 |
T |
|
| Q |
155 |
ccatttccgtcttcacttcactcgtttatcggtatctccactttatttatattttactcggacttgatccgacccgatagttccggaatggacccctatc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861117 |
ccatttccgtcttcacttcactcgtttatcggtatctccactttatttatattttactcggacttgatccgacccgatagttccggaatggacccctatc |
32861216 |
T |
|
| Q |
255 |
ctaacccgttaattaaatgatacccaaactcatattctgcttaacctcgggtcatccgccccaacatataaattttcagtgttccctttctctgcgatat |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32861217 |
ctaacccgttaattaaatgatacccaaactcatattctgcttaacctcgggtcatccgccccaacatataaattttcagtgttccctttctctgcgattt |
32861316 |
T |
|
| Q |
355 |
tcttc |
359 |
Q |
| |
|
||||| |
|
|
| T |
32861317 |
tcttc |
32861321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 40
Target Start/End: Original strand, 32860962 - 32860996
Alignment:
| Q |
6 |
atcattcattctattcgttttcattcaaactagtt |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860962 |
atcattcattctattcgttttcattcaaactagtt |
32860996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University