View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_10 (Length: 271)
Name: NF5296_low_10
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 131 - 259
Target Start/End: Complemental strand, 52396031 - 52395903
Alignment:
| Q |
131 |
aaaattaattttgttaaaaagttgatttaacataaaatgattcatatttatagggagctatgaatgtttggttcctcttttacagatgttgaattgattt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52396031 |
aaaattaattttgttaaaaagttgatttaacataaaatgatccatatttatagggagctatgaatgtctggttcctcttttacagatgttgaattgattt |
52395932 |
T |
 |
| Q |
231 |
ttgacatgtttgttgttctcgattagaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52395931 |
ttgacatgtttgttgttctcgattagaat |
52395903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 52396084 - 52396050
Alignment:
| Q |
20 |
catatgttatcattgcatacatatttataatcttg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396084 |
catatgttatcattgcatacatatttataatcttg |
52396050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University