View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_12 (Length: 256)
Name: NF5296_low_12
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_12 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 1923073 - 1923311
Alignment:
| Q |
18 |
tataaagatcagacgactcatattttaagttagagttgatttagtaaaatcaatgagtcgtttcatctttattatataatcagaatctaaactttgtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1923073 |
tataaagatcagacgactcatattttaagttagagttgatttagtaaaatcaatgagtcgtttcatctttattatatagtcagaatctaaactttgtgtt |
1923172 |
T |
 |
| Q |
118 |
ttctcttactagttagtcgtttcatctttatgttatagtcgatacctctaattaaatgatacttttgttgatttacacagattgtacactccgttgataa |
217 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1923173 |
ttctcttactagtcagtcgttttatctttatgttatagtcgatacctctaattaaatgatacttttgttgatttacacagattgtacactccgttgataa |
1923272 |
T |
 |
| Q |
218 |
gatggcaatatggccccgtttacctgttttcttaggcct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1923273 |
gatggcaatatggccccgtttacctgttttcttaggcct |
1923311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 196 - 253
Target Start/End: Original strand, 1937117 - 1937174
Alignment:
| Q |
196 |
agattgtacactccgttgataagatggcaatatggccccgtttacctgttttcttagg |
253 |
Q |
| |
|
|||||||||||||| |||| ||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1937117 |
agattgtacactccattgacaagttgggaatatggcaccgtttacctgttttcttagg |
1937174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University