View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5296_low_13 (Length: 251)

Name: NF5296_low_13
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5296_low_13
NF5296_low_13
[»] scaffold0536 (1 HSPs)
scaffold0536 (58-233)||(7538-7715)


Alignment Details
Target: scaffold0536 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 58 - 233
Target Start/End: Original strand, 7538 - 7715
Alignment:
58 agacggattgtcaaatatcacatgaaaaccta--cacacaaatgaatttaggcatttttcaattgagtcaaaacctgctgataatacttttctttatgtg 155  Q
    |||| |||||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
7538 agactgattgtcaaatatcacatgaaaacctatacacacagatgaatttaggcatttttcaattgagtcaaaacctgcggataatacttttctttgtgtg 7637  T
156 ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataatacttcttctacttttgttactatcgtcta 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7638 ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataatacttcttctacttttgttactatcgtcta 7715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University