View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_13 (Length: 251)
Name: NF5296_low_13
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_13 |
 |  |
|
| [»] scaffold0536 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0536 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 58 - 233
Target Start/End: Original strand, 7538 - 7715
Alignment:
| Q |
58 |
agacggattgtcaaatatcacatgaaaaccta--cacacaaatgaatttaggcatttttcaattgagtcaaaacctgctgataatacttttctttatgtg |
155 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7538 |
agactgattgtcaaatatcacatgaaaacctatacacacagatgaatttaggcatttttcaattgagtcaaaacctgcggataatacttttctttgtgtg |
7637 |
T |
 |
| Q |
156 |
ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataatacttcttctacttttgttactatcgtcta |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7638 |
ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataatacttcttctacttttgttactatcgtcta |
7715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University