View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_18 (Length: 212)
Name: NF5296_low_18
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 42613493 - 42613671
Alignment:
| Q |
18 |
atatcgatgatcgtataaaagcacaaactatcttttcaactttcacctctcacactttgctcttatattgacttgagcgtcaaagtgtttgcaggtacct |
117 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42613493 |
atatcgatgaccgtataaaagcacacactatcttttcaactttcacctctcacactttgctcttatattgacttgagcgtcaaagtgtttgcaggtacct |
42613592 |
T |
 |
| Q |
118 |
tcaacttgtacctcgacaattgcggcccgacaaggacatcattttgatcactctggataaagtgtgttgctagcgcttg |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42613593 |
tcaacttgtagctcgacaattgcggcccggcaaggacatcattttgatcactctagataaagtgtgttgctagcgcttg |
42613671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 83 - 116
Target Start/End: Complemental strand, 52377657 - 52377624
Alignment:
| Q |
83 |
tattgacttgagcgtcaaagtgtttgcaggtacc |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
52377657 |
tattgacttgatcgtcaaagtgtttgcaggtacc |
52377624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University