View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_8 (Length: 308)
Name: NF5296_low_8
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 105 - 284
Target Start/End: Original strand, 7645640 - 7645819
Alignment:
| Q |
105 |
tctaactgcaaatacatgtgtttattgcataaaccactacacacaagaaaaacctaagcatttgcgctgctctggtgcctagctttttccttctctttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645640 |
tctaactgcaaatacatgtgtttattgcataaaccactacacacaagaaaaacctaagcattggcgctgctctggtgcctagctttttccttctctttca |
7645739 |
T |
 |
| Q |
205 |
cctcgcttccctgtgtcttgtcataatcttcatgcacaaaaacaaacaagtctgaattaggcttaataattaatttccat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7645740 |
cctcgcttccctgtgtcttgtcataatcttcatgcacaaaaacaaacaagtcttaattaggcttaataattaatttccat |
7645819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 7645545 - 7645583
Alignment:
| Q |
10 |
ataatacttatacataattgtccatattatcactctgag |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645545 |
ataatacttatacataattgtccatattatcactctgag |
7645583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University