View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5296_low_9 (Length: 291)
Name: NF5296_low_9
Description: NF5296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5296_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 52386269 - 52386514
Alignment:
| Q |
16 |
attataaacatgaaatactgtatattcttataattcacttgagacatcataccaggattttgatttttcatgttgacaacatccatactctgtattgttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386269 |
attataaacatgaaatactgtatattcttataattcacttgagacatcataccaggattttgatttttcatgttgacaacatccatactctgtattgttg |
52386368 |
T |
 |
| Q |
116 |
attttatttaccatttattcatttacagtaagttaacaacattcatacttttataatcatatatatgacaggaacttcgctaccaatctgaaagatcaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
52386369 |
attttatttaccatttattcatttacagtaagttaacaacattcatacttttataatc----atatgaaaggaacttcgctaccaatctgaaagatcaca |
52386464 |
T |
 |
| Q |
216 |
agttattggacgcatatgcaatggttgctataagaatttcttatcttcta |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386465 |
agttattggacgcatatgcaatggttgctataagaatttcttatcttcta |
52386514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University