View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_high_12 (Length: 257)
Name: NF5297_high_12
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 44188353 - 44188603
Alignment:
| Q |
7 |
agtaagtaatatgagaagaaactgcatgactccagtctccaggctctggatgtggagtgtggaccttctatcatcactatcataggtccaattagcatta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188353 |
agtaagtaatatgagaagaaactgcatgactccagtctccagcctctggatgtggagtgtggaccttctatcatcactatcataggtccaattagcatta |
44188452 |
T |
 |
| Q |
107 |
caaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacattctaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188453 |
caaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacattctaa |
44188552 |
T |
 |
| Q |
207 |
tgagattgcaaatgcagtagttgggacataatttgccataccttgttcata |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188553 |
tgagattgcaaatgcagtagttgggacataatttgccataccttgttcata |
44188603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 7 - 182
Target Start/End: Original strand, 1329591 - 1329761
Alignment:
| Q |
7 |
agtaagtaatatgagaagaaactgcatgactccagtctccaggctctggatgtggagtgtg--gaccttctatcatcactatcataggtccaattagcat |
104 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1329591 |
agtaagtaatatgagtagaaactacatgactccag-------gctctggatgtggagtgttttgaccttttatcatcactatcataggtccaactagcat |
1329683 |
T |
 |
| Q |
105 |
tacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaa |
182 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||| || |||||||| |||||||||||| |
|
|
| T |
1329684 |
tacaaaatgctggcagactaaggcaagtttgttggctgctaaacgagaccaaaattagtggtcccattgagatatcaa |
1329761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University