View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_low_11 (Length: 282)
Name: NF5297_low_11
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 191 - 282
Target Start/End: Complemental strand, 4855603 - 4855513
Alignment:
| Q |
191 |
tgatatatttgcaggggagtatggtatactttgttgattggttctttgctaccttcgcaacccaagagtatggtattttggttcttcttgac |
282 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4855603 |
tgatatatttgcaagggagtatggt-tacttggttgattggttctttgctaccttcgcaacccaagagtatggtattttggttcttcttgac |
4855513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University