View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_low_13 (Length: 269)
Name: NF5297_low_13
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_low_13 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 184 - 269
Target Start/End: Original strand, 2069117 - 2069202
Alignment:
| Q |
184 |
gaaggttgaatggtacaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgatttt |
269 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2069117 |
gaaggttgaatggtacaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgatttt |
2069202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 198 - 269
Target Start/End: Original strand, 2073477 - 2073548
Alignment:
| Q |
198 |
acaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgatttt |
269 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2073477 |
acaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgatttt |
2073548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 13 - 103
Target Start/End: Original strand, 2068939 - 2069029
Alignment:
| Q |
13 |
agcataggtggaaaatttgaagatcccaaattaagtagacacctctaaagaaccctcatcttctgtctctcacttacaagatatattatta |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| ||||||| |||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
2068939 |
agcataagtggaaaatttgaagatcccaaattaggtaaacacctccaaagaaccctcatcctctctctctcacttataagatatattatta |
2069029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University