View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_low_14 (Length: 268)
Name: NF5297_low_14
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_low_14 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 197 - 268
Target Start/End: Complemental strand, 31270179 - 31270108
Alignment:
| Q |
197 |
gcccatattaacagtaattcgatatattaggacattttcttctggaacccagtcaaaactcatggtttgtta |
268 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31270179 |
gcccatattaacagtaattcgatttattaggacattttcttctggaacccagtcaaaacttatggtttgtta |
31270108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 31270352 - 31270264
Alignment:
| Q |
23 |
tttggtttttggcaacaaatctgagcgtaatttgttattttctccatcagctattccatattgttgatttctaagaacatatttattaag |
112 |
Q |
| |
|
|||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
31270352 |
tttgattttgggcaacaaatcagagcgtaatttgttattttctccatcagctattccatattg-tgatttctaaaaccatatttattaag |
31270264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University