View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_low_22 (Length: 239)
Name: NF5297_low_22
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26827090 - 26826866
Alignment:
| Q |
1 |
aaaataagctacatggagcaccacacgatacatgcataaaccttagtactagaataaaaacacgtgcatgcatttaatccatttaagaaaaaactcaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26827090 |
aaaataagctacatggagcaccacacgatacatgcataaaccttagtactagaataaaaacacgtgcatgcatttaatccattgaagaaaaaactcaagt |
26826991 |
T |
 |
| Q |
101 |
tgattgacaattgcaactttggcttcacattccacatgcagtaggtcctacaaaatatatatacacaccaatagattgaatagtaaaaacatactgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26826990 |
tgattgacaattgcaactttggcttcacatcccacatgcagtaggtcctacaaaatatatatacacaccaatagattgaatagtaaaaacatactgtttt |
26826891 |
T |
 |
| Q |
201 |
ctgaggggaccagaaacacactcgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26826890 |
ctgaggggaccagaaacacactcgt |
26826866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 47 - 97
Target Start/End: Complemental strand, 26806674 - 26806624
Alignment:
| Q |
47 |
tactagaataaaaacacgtgcatgcatttaatccatttaagaaaaaactca |
97 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26806674 |
tactagaacaaaaacatgtgcgtgcatttaatccattgaagaaaaaactca |
26806624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University