View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5297_low_6 (Length: 370)
Name: NF5297_low_6
Description: NF5297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5297_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 32 - 362
Target Start/End: Complemental strand, 47851588 - 47851258
Alignment:
| Q |
32 |
attgactaagaccaaattggttcaggtggaagagcgcgttgttgctgtggatgaattgactgaagcagatgaagttttctgtacaggaactgccgttggt |
131 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851588 |
attgattaagatcaaattggttcaggtggaagagcgcgttgttgctgtggatgaattgactgaggcagatgaagttttctgtacaggaactgccgttggt |
47851489 |
T |
 |
| Q |
132 |
gttgctcctgtagggagcatcacataccagaataaaaggtaaagtaattgattggaaacatatttattagatacaagggatgcagaaaaaagagtgaatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47851488 |
gttgctcctgtagggagcatcacataccagaataaaaggtaaagtaattgattggaaacatatttattagatacaaaggatgcagaaaaaagagtgaatt |
47851389 |
T |
 |
| Q |
232 |
acaaggatgtaatgcaagtcaagtatatattgtcaacctttttgttttgagtgaagatacatatgcattatcagtcttaattacttgtagtatttctttt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851388 |
acaaggatgtaatgcaagtcaagtatatattgtcaacctttttgttttgagtgaagatacatatacattatcagtcttaattacttgtagtatttctttt |
47851289 |
T |
 |
| Q |
332 |
tatcgcacttttatgaaacactagtattatc |
362 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
47851288 |
tatcgcacttttatgaaacactagtaatatc |
47851258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University